|
Left Crispr |
Right Crispr |
| Crispr ID |
953853241 |
953853244 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:46481625-46481647
|
3:46481659-46481681
|
| Sequence |
CCTGTAATCATAGCTACTCGGGA |
AAGAATCACTTGAACCTGAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 18, 1: 2364, 2: 58618, 3: 232401, 4: 264144} |
{0: 7, 1: 291, 2: 4964, 3: 34790, 4: 85087} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|