ID: 953860094_953860106

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 953860094 953860106
Species Human (GRCh38) Human (GRCh38)
Location 3:46536997-46537019 3:46537046-46537068
Sequence CCATCTATCTTGCTGCCAACCAC TGGCAAGGATCCCTGAGTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 487} {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!