ID: 953863762_953863776

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 953863762 953863776
Species Human (GRCh38) Human (GRCh38)
Location 3:46566142-46566164 3:46566171-46566193
Sequence CCGCCCCCCGGCCACCTCGGACG GCTTACCTGCCCCGAGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 205} {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!