ID: 953878035_953878049

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 953878035 953878049
Species Human (GRCh38) Human (GRCh38)
Location 3:46677377-46677399 3:46677419-46677441
Sequence CCCTCTGCCCTCCCTTACAGCTG CCCGCCCTGGCCAACAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 425} {0: 1, 1: 0, 2: 0, 3: 26, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!