ID: 953878035_953878051

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 953878035 953878051
Species Human (GRCh38) Human (GRCh38)
Location 3:46677377-46677399 3:46677420-46677442
Sequence CCCTCTGCCCTCCCTTACAGCTG CCGCCCTGGCCAACAGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 425} {0: 1, 1: 0, 2: 0, 3: 24, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!