ID: 953878035_953878054

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 953878035 953878054
Species Human (GRCh38) Human (GRCh38)
Location 3:46677377-46677399 3:46677425-46677447
Sequence CCCTCTGCCCTCCCTTACAGCTG CTGGCCAACAGGCTGGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 425} {0: 1, 1: 0, 2: 2, 3: 41, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!