ID: 953885427_953885433

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 953885427 953885433
Species Human (GRCh38) Human (GRCh38)
Location 3:46712220-46712242 3:46712249-46712271
Sequence CCACAAGTGAGGGAGGGCACACA GAGGGCAGCAAGGAGGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 174} {0: 1, 1: 2, 2: 7, 3: 80, 4: 854}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!