ID: 953885686_953885692

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 953885686 953885692
Species Human (GRCh38) Human (GRCh38)
Location 3:46713260-46713282 3:46713283-46713305
Sequence CCTTGCCGGGCCTGCTCTCGCTT CCTGCAGTGCCCAGGCCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 436} {0: 1, 1: 0, 2: 9, 3: 39, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!