ID: 953888355_953888367

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 953888355 953888367
Species Human (GRCh38) Human (GRCh38)
Location 3:46732903-46732925 3:46732936-46732958
Sequence CCCCATCACAGAGTTGTCCACGT GGGAGGGAGGGCCATTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 115} {0: 1, 1: 0, 2: 4, 3: 24, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!