ID: 953890815_953890830

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 953890815 953890830
Species Human (GRCh38) Human (GRCh38)
Location 3:46750572-46750594 3:46750617-46750639
Sequence CCGCAAAAATCCCCGACCCAGGA AGTCCCCCGCCTCCAAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 119} {0: 1, 1: 0, 2: 0, 3: 23, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!