ID: 953899772_953899776

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 953899772 953899776
Species Human (GRCh38) Human (GRCh38)
Location 3:46833548-46833570 3:46833573-46833595
Sequence CCCACGTGGCGGTGACCAGGGTG GCCGCAGATGTGCCTGCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64} {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!