ID: 953925930_953925952

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 953925930 953925952
Species Human (GRCh38) Human (GRCh38)
Location 3:46982431-46982453 3:46982463-46982485
Sequence CCCACCCACCCCCTCCCCCTGGG CAACTGGGGGCCTCATAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 152, 4: 1343} {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!