ID: 953980345_953980353

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 953980345 953980353
Species Human (GRCh38) Human (GRCh38)
Location 3:47410312-47410334 3:47410336-47410358
Sequence CCCACAGCATGGCGTGGTGAGCA TCCCTATGTGGGGGTAGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 92} {0: 1, 1: 0, 2: 1, 3: 23, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!