ID: 953996272_953996274

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 953996272 953996274
Species Human (GRCh38) Human (GRCh38)
Location 3:47522437-47522459 3:47522455-47522477
Sequence CCTTAGCTCATCTCTCTGGAGCC GAGCCCAGTGGTAGTCTTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!