ID: 954003937_954003950

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 954003937 954003950
Species Human (GRCh38) Human (GRCh38)
Location 3:47578072-47578094 3:47578104-47578126
Sequence CCCCAGCCACCCGGTACCTCTAA CGGAGTCTGCCCCCAAGACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113} {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!