ID: 954012521_954012529

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 954012521 954012529
Species Human (GRCh38) Human (GRCh38)
Location 3:47654603-47654625 3:47654651-47654673
Sequence CCACAGACTTAGAAGTTCAAGGG TTTTGTTCTGTGTCGCAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172} {0: 1, 1: 0, 2: 7, 3: 44, 4: 476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!