ID: 954055172_954055176

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 954055172 954055176
Species Human (GRCh38) Human (GRCh38)
Location 3:48017119-48017141 3:48017172-48017194
Sequence CCCTCACTTTAATAGATGGAAAA TACAAATGAGGCTGAGACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 392} {0: 1, 1: 1, 2: 3, 3: 47, 4: 662}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!