ID: 954062984_954062987

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 954062984 954062987
Species Human (GRCh38) Human (GRCh38)
Location 3:48084463-48084485 3:48084485-48084507
Sequence CCAAAATAGTTCACCATAAGGTC CTGCATTTAAAGACTGGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101} {0: 1, 1: 0, 2: 3, 3: 22, 4: 540}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!