ID: 954085533_954085538

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 954085533 954085538
Species Human (GRCh38) Human (GRCh38)
Location 3:48241243-48241265 3:48241260-48241282
Sequence CCATTCGGTGCTCCAGCCGCAGG CGCAGGCGCCGCGCAGGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102} {0: 1, 1: 0, 2: 1, 3: 9, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!