ID: 954087781_954087787

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 954087781 954087787
Species Human (GRCh38) Human (GRCh38)
Location 3:48259553-48259575 3:48259595-48259617
Sequence CCTGAGAATAGGAGGAAGAAGCT CAGGGTAATCAGAGGCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 333} {0: 1, 1: 0, 2: 1, 3: 17, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!