ID: 954089974_954089978

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 954089974 954089978
Species Human (GRCh38) Human (GRCh38)
Location 3:48276590-48276612 3:48276607-48276629
Sequence CCCCTTCAGAGAAGCCACTGACC CTGACCCCGTGCCTTGCTTATGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 6, 3: 18, 4: 173} {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!