ID: 954089976_954089981

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 954089976 954089981
Species Human (GRCh38) Human (GRCh38)
Location 3:48276592-48276614 3:48276611-48276633
Sequence CCTTCAGAGAAGCCACTGACCCC CCCCGTGCCTTGCTTATGGCGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 5, 3: 26, 4: 215} {0: 1, 1: 0, 2: 0, 3: 7, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!