|
Left Crispr |
Right Crispr |
| Crispr ID |
954099347 |
954099350 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:48357585-48357607
|
3:48357622-48357644
|
| Sequence |
CCTCTCTGCAGCTGGTAATCCTG |
CTCTGAAATTCTCAGCAAAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 51, 2: 99, 3: 251, 4: 499} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|