ID: 954108703_954108712

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 954108703 954108712
Species Human (GRCh38) Human (GRCh38)
Location 3:48422592-48422614 3:48422632-48422654
Sequence CCTAGCGGGGATGGAGGAAAGTC AGTCCTGGGGAGAGGAGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105} {0: 1, 1: 0, 2: 1, 3: 44, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!