ID: 954108711_954108719

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 954108711 954108719
Species Human (GRCh38) Human (GRCh38)
Location 3:48422630-48422652 3:48422661-48422683
Sequence CCAGTCCTGGGGAGAGGAGCTCA CTCCTGGCCCAGGGGTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 237} {0: 1, 1: 0, 2: 2, 3: 34, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!