ID: 954108713_954108717

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 954108713 954108717
Species Human (GRCh38) Human (GRCh38)
Location 3:48422635-48422657 3:48422653-48422675
Sequence CCTGGGGAGAGGAGCTCAGGTCA GGTCATCTCTCCTGGCCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 328} {0: 1, 1: 0, 2: 1, 3: 21, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!