ID: 954108721_954108732

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 954108721 954108732
Species Human (GRCh38) Human (GRCh38)
Location 3:48422668-48422690 3:48422718-48422740
Sequence CCCAGGGGTCACAGGGATAGCTT TTCCCTCCAGACTCTGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 129} {0: 1, 1: 0, 2: 1, 3: 33, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!