ID: 954129780_954129784

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 954129780 954129784
Species Human (GRCh38) Human (GRCh38)
Location 3:48554520-48554542 3:48554546-48554568
Sequence CCCTCAGCTCAGGCCAGAGCCAC TCAGTTCCACACTTAGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 327} {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!