ID: 954132355_954132369

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 954132355 954132369
Species Human (GRCh38) Human (GRCh38)
Location 3:48567135-48567157 3:48567173-48567195
Sequence CCTTTCTCGCCCTGGTCACCCTT GTCAAAGCCTCGGTCACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 201} {0: 1, 1: 0, 2: 1, 3: 6, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!