ID: 954133698_954133708

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 954133698 954133708
Species Human (GRCh38) Human (GRCh38)
Location 3:48572488-48572510 3:48572524-48572546
Sequence CCCACACACACTCACCTTCTCTC GAGCCCGACCACAGCCTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 119, 4: 836} {0: 1, 1: 0, 2: 3, 3: 18, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!