ID: 954134125_954134139

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 954134125 954134139
Species Human (GRCh38) Human (GRCh38)
Location 3:48574356-48574378 3:48574408-48574430
Sequence CCACCCACCATCCCCCTAGACAG CAGACCCCAGCCCTGCACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 430} {0: 1, 1: 0, 2: 4, 3: 50, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!