ID: 954138136_954138141

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 954138136 954138141
Species Human (GRCh38) Human (GRCh38)
Location 3:48591700-48591722 3:48591715-48591737
Sequence CCACCTCGTGGCCCTCCAGCAGA CCAGCAGAGTGTAGAGTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 182} {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!