ID: 954141635_954141642

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 954141635 954141642
Species Human (GRCh38) Human (GRCh38)
Location 3:48609781-48609803 3:48609818-48609840
Sequence CCGCGCTGCCGCCAGTCCCTGCG TGCCGTCCATCAGCCCGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 267} {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!