ID: 954145537_954145556

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 954145537 954145556
Species Human (GRCh38) Human (GRCh38)
Location 3:48632625-48632647 3:48632675-48632697
Sequence CCCTGTCCCACCTGTGTCTACTG AGTAGGGAAGGGGTCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 228} {0: 1, 1: 0, 2: 3, 3: 68, 4: 696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!