ID: 954150132_954150148

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 954150132 954150148
Species Human (GRCh38) Human (GRCh38)
Location 3:48653177-48653199 3:48653224-48653246
Sequence CCCCGATCTAGCTGTGGGCAGAG CCATGTGGGCTGGGACTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 207} {0: 1, 1: 0, 2: 4, 3: 49, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!