ID: 954150138_954150151

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 954150138 954150151
Species Human (GRCh38) Human (GRCh38)
Location 3:48653208-48653230 3:48653245-48653267
Sequence CCCTGGGGTTAGAGCCCCATGTG GGTGAGATCAGAGGGCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133} {0: 1, 1: 0, 2: 0, 3: 29, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!