ID: 954159266_954159268

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 954159266 954159268
Species Human (GRCh38) Human (GRCh38)
Location 3:48708794-48708816 3:48708814-48708836
Sequence CCGTGTGGTGGCTCACACACGTG GTGTAATCCTAGCACTTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 173} {0: 2, 1: 367, 2: 4496, 3: 6587, 4: 5568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!