ID: 954176220_954176229

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 954176220 954176229
Species Human (GRCh38) Human (GRCh38)
Location 3:48847771-48847793 3:48847804-48847826
Sequence CCACGGCCGACCTGGCACCGCCG TGGGCAGCCGCCGCCGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 142} {0: 1, 1: 0, 2: 13, 3: 83, 4: 477}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!