ID: 954176225_954176234

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 954176225 954176234
Species Human (GRCh38) Human (GRCh38)
Location 3:48847788-48847810 3:48847814-48847836
Sequence CCGCCGCCGCTGTCACTGGGCAG CCGCCGCCGCGGGGACCGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 198} {0: 1, 1: 0, 2: 3, 3: 16, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!