ID: 954176225_954176242

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954176225 954176242
Species Human (GRCh38) Human (GRCh38)
Location 3:48847788-48847810 3:48847834-48847856
Sequence CCGCCGCCGCTGTCACTGGGCAG GGGCAGGCGAGCTGGACGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 198} {0: 1, 1: 0, 2: 1, 3: 22, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!