ID: 954176227_954176245

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954176227 954176245
Species Human (GRCh38) Human (GRCh38)
Location 3:48847794-48847816 3:48847840-48847862
Sequence CCGCTGTCACTGGGCAGCCGCCG GCGAGCTGGACGGGCGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 147} {0: 1, 1: 1, 2: 3, 3: 50, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!