ID: 954176231_954176244

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 954176231 954176244
Species Human (GRCh38) Human (GRCh38)
Location 3:48847811-48847833 3:48847836-48847858
Sequence CCGCCGCCGCCGCGGGGACCGAC GCAGGCGAGCTGGACGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 376} {0: 1, 1: 0, 2: 2, 3: 14, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!