ID: 954193925_954193928

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 954193925 954193928
Species Human (GRCh38) Human (GRCh38)
Location 3:48984887-48984909 3:48984914-48984936
Sequence CCTTTTTCCTTCCTCAGGTTTTG TTCCTGTGTTGTCCCCAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 617} {0: 1, 1: 0, 2: 2, 3: 18, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!