ID: 954193926_954193928

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 954193926 954193928
Species Human (GRCh38) Human (GRCh38)
Location 3:48984894-48984916 3:48984914-48984936
Sequence CCTTCCTCAGGTTTTGTCTCTTC TTCCTGTGTTGTCCCCAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 375} {0: 1, 1: 0, 2: 2, 3: 18, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!