ID: 954197345_954197353

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 954197345 954197353
Species Human (GRCh38) Human (GRCh38)
Location 3:49004608-49004630 3:49004655-49004677
Sequence CCGCCCCCTTTATTTAGTGGAAA GTCTCTGTCTTTGGCATCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 202} {0: 1, 1: 0, 2: 3, 3: 28, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!