ID: 954200939_954200946

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 954200939 954200946
Species Human (GRCh38) Human (GRCh38)
Location 3:49022710-49022732 3:49022742-49022764
Sequence CCACCAGGACATCACCGAAGACA TCTTCTGGTTGCTGGAGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 137} {0: 1, 1: 0, 2: 3, 3: 23, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!