ID: 954201306_954201313

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 954201306 954201313
Species Human (GRCh38) Human (GRCh38)
Location 3:49024977-49024999 3:49025002-49025024
Sequence CCATCGGAAAAGAAGTATTCACC GGGCCTCAGTGGTGGCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 109} {0: 1, 1: 5, 2: 6, 3: 41, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!