ID: 954210411_954210420

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 954210411 954210420
Species Human (GRCh38) Human (GRCh38)
Location 3:49093930-49093952 3:49093956-49093978
Sequence CCGCCGCCGCCGCCTCCGCTGCA GCCGGCCCCGCCGCACCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 180, 3: 1910, 4: 3479} {0: 1, 1: 0, 2: 2, 3: 44, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!