|
Left Crispr |
Right Crispr |
| Crispr ID |
954233074 |
954233077 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:49233792-49233814
|
3:49233809-49233831
|
| Sequence |
CCATGCTGAAGGTTGTGGGTTTA |
GGTTTACCAGAATGAGGGCAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 29, 1: 66, 2: 79, 3: 119, 4: 1717} |
{0: 126, 1: 200, 2: 352, 3: 220, 4: 180} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|