ID: 954233074_954233081

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 954233074 954233081
Species Human (GRCh38) Human (GRCh38)
Location 3:49233792-49233814 3:49233829-49233851
Sequence CCATGCTGAAGGTTGTGGGTTTA AGGAACACTTGGCCCACCGAGGG
Strand - +
Off-target summary {0: 29, 1: 66, 2: 79, 3: 119, 4: 1717} {0: 1, 1: 7, 2: 319, 3: 319, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!